Department of Radiation Oncology, Ruijin Hospital, Shanghai Jiaotong University School of Medicine, Shanghai, China ...

The sequences of the siRNAs are following: sense sequence of #1 siRNA, GGAGUGAUCCUUAUCGUGATT; antisense sequence of #1 siRNA, UCACGAUAAGGAUCACUCCAG, sense sequence of #2 siRNA, CUUGCUUAAUAUACAGAAATT; ...

The First Affiliated Hospital of Shantou University Medical College, Shantou 515063, China Department of Urology, Shenzhen Institute of Translational Medicine, Shenzhen Second People’s Hospital, The ...